Essay on Functionalism - 1313 Words

Theories have been composed and exposed by various philosophers to clarify their reasoning about the mind. Dualism, Behaviorism, and Identity Theory, are well-known theories supported by well-written explanations. A modern theory, Functionalism provides ample insight to the main problem philosophers deal with, the mind/body problem. Functionalism was developed as a combination of the Behaviorist theory and the Identity theory. Behaviorism believes being in a mental state is the same as a physical state, which is a noticeable behavioral characteristic. For instance, if one claims they are unhappy, there physical state could include a frowning display or inappropriate posture. On the other hand, the Identity Theory suggests when one†¦show more content†¦If the machine is in S2, and sees a â€Å"1†, it says Even and returns to S1. The purpose of this case Block provided us is to give us a direct insight to how a functionalist theory works. The nature of a mental state in a human mind is equivalent to the nature of a machines state; therefore, it can demonstrate the relations to other states and to inputs and outputs. Functionalism is the dogma for creating something a thought; a desire, a belief, pain, or satisfaction by allowing its dependence only on the role it plays in the cognitive system. Another classic example demonstrated through the functionalist theory, is being in a mental state of pain that induces the notion that something is wrong with one’s body, where the individual wishes to be out of its mental state and as a result, possible behavioral outputs may include wincing, moaning, crying, or anxiety. In the functionalist theory, it states that any creature that is capable of a mental state and meets its conditions experiences pain (Levin). Humans have a process of neural activity, for instance C-fiber stimulation, which meets the conditions of functionalism. Therefore, humans can experience pain by C-fiber stimulation. The theor y also allows other creatures with different physical makeups that have mental states can also experience pain. Functionalist became aware that creatures with different types of physical states could experience pain. AShow MoreRelatedFunctionalism And Functionalism Of Functionalism1837 Words   |  8 PagesA Functionalism is the theory that what makes something a mental state depends on its function or role in the cognitive system, instead of its internal constitution. To put it another way, functionalism holds that mental states correspond to functional states. Functionalism is the offspring of both identity theory and behaviorism, and comes in a few different flavors. For example, there is machine functionalism, psycho-functionalism, analytic functionalism, role-functionalism and realizer-functionalismRead MoreFunctionalism And The Inverted Spectrum1545 Words   |  7 Pagesimportant challenge to functionalist accounts of qualia. Functionalism is committed to defining mental s tates in terms of their cause and effects . By identifying sensory events with casual roles, however, functionalism appears to be missing qualitative aspects all together. The topic of spectrum inversion has often been raised as a contradiction to functionalism, as well as other materialist theories about consciousness. These negates to functionalism show that even when all the relevant physical factsRead MoreEssay on Functionalism in Education1134 Words   |  5 Pagesï » ¿ Having attended public schools throughout my childhood and adolescence, I never was familiar with the term functionalism and its many elements. After observing and analyzing my field placement classroom I have come to understand the concept of functionalism to some extent. In general, functionalists â€Å"see schools as serving to socialize students to adapt to the economic, political, and social institutions of that society† (Feinberg, p.6, 2004). They also theorize that in order for societies toRead MoreFunctionalism Of Brazil : Cause Or Style?1623 Words   |  7 PagesFunctionalism in Brazil: cause or style? The premise form follows function was first used by Sullivan in the late nineteenth century and built by Modernist Architecture in Europe in the twentieth century. Reflecting specifically on the Brazilian case, functionalism was an aspect of tension throughout the process of assimilation and appropriation of Modernism as a national language in the twentieth century, because on one side could be an important tool for democratization of accessing to certainRead MoreStructural Functionalism And Functional Theory Essay1187 Words   |  5 PagesStructural Functionalism (SF) theory often referred to as Structural Function Theory or Functional Theory, no matter what name is used, the main context of the theory remains the same. There are many existent interpretations of the theory, however according to Smith and Hamon (2012) SF theory is based on two basic assumptions agreed by all: (a) â€Å"the functions of families is to procreate and socialize children† and (b) â€Å"all syste ms have functions† (p. 44). Additionally, they further elaborate on functionalRead MoreFunctionalism And Its Impact On Physical Body Essay1934 Words   |  8 Pageswith our physical body? Do they interact at all? Are they two separate entities or one in the same? Many theories try to answer these types of questions, but the one I will be focusing on is role functionalism. When mentioning functionalism throughout, I will be referring to role functionalism. Functionalism is a theory that says mental states can be defined by their function. So, we can identify mental states with their functional states. We can come to know the function of a mental state through examiningRead MoreStructural Functionalism And Its Impact On Society Essay911 Words   |  4 PagesStructural functionalism â€Å"is a macro-level theory that views a society as a complete unit† (Grand Canyon). Structural functionalism shows how society works together. It also brings out the individual roles, stri cter and functions that people in society have. In our book figure 2.1 displays a few examples. It has politics listed as the structure and their function is to maintain order and control. The world works with this theory because you need the ones in the structural positions to be able toRead MoreConflict Theory Vs. Structural Functionalism978 Words   |  4 PagesConflict Theory vs. Structural Functionalism, this is like a fight between conservative and liberal. Structural Functionalism is a sociological theory that focuses on the structures of society and their functional significance (positive and negative consequences) for other structures (Ritzer, 2013). In another word, Structural Functionalism focuses on hierarchy, high position in the society. The theory is based on the belief that a person who held a high position like doctor or lawyer should getRead MoreGeorge Peter Murdocks Theory Of Structural Functionalism953 Words   |  4 Pages In the theory of Structural Functionalism, one believes that society is made up of many parts which depend on each other to work and if one fails, all will fail. Imagine the body; each organ has a set function. If the heart stopped doing what it was supposed to be doing and tried to digest your food, what would happen? Functionalists consider family as an essential building block of society. This is an analogy to decide that if one part of society actually starts failing, the society dies. GeorgeRead MoreFunctionalism : Functionalism And Functionalism1100 Words   |  5 PagesFUNCTIONALISM AND WEBERIANISM Functionalism has been focused on different parts of the societies ‘functioning’ to keep up social order and foundation. Emile Durkheim, Talcott Parsons and Robert Merton were the three main theorists of functionalism, where they studied to understand how different parts of society could connect and work towards promoting social steadiness and harmony. Parsons viewed health as an important part of foundation and building a better society where illness has stopped

Since Its Beginning, Women’S Reproduction Has Been A...

Since its beginning, women’s reproduction has been a controversial and debated topic in the United States. Views on sexuality and gender, civil rights movements, and religious views have all had an effect on the control of women’s reproduction. While historical events have had some effect on current debates, some events have been overlooked or ignored by those involved in disputes involving reproductive rights. One of these time periods that is often not discussed is the colonial period. In the 1700s, abortion was actually quite common during the first trimester. During this time period, a lack of menstruation was not necessarily seen to be a sign of pregnancy. The medical theory Humorism was prevalent during this era, and a woman’s lack†¦show more content†¦Society during this time did not view women as in control of their sexuality. Women were seen as passionate, irrational beings, so premarital sex by women was seen as a sin, but men were generally h eld responsible. Men often faced pressure from the church, courts and their family until they would agree to marry the woman. In current debates, religion, particularly christianity, is often used as a justification for the â€Å"pro life† view on abortion. It is interesting that in the 1700s, in which the church was arguably more involved in the government and was generally more conservative than it is now, that abortion was not condemned. It is also surprising that in our modern era in which church is not technically supposed to be involved in government matters that religious rhetoric is used so often to justify the view that abortion and contraception should not be available to women. As the eighteenth century transitioned into the nineteenth century, views on reproduction and sexuality changed. The way that women and men were viewed and treated in instances of unwanted pregnancy and premarital sex began to shift. The views of the church, government, and medical world also began to shift. This is when an opposition to abortion and contraception which is felt in today’s political climate truly began to develop. During the late eighteenth into the nineteenth century, views on contraception and abortion began to change. There was the rise of a double standard betweenShow MoreRelatedCovering Information During the Civil Rights Movement1816 Words   |  7 Pagessuited for civil rights is written by Kenji Yoshino who defines covering as having to play down your outsider identity in order to blend into the mainstream. To me the biggest one it relates to is homosexuality and gender identity. Although there has been a tremendous amount of progress over the years with giving the LGBT community the same rights as straight people they still are not considered equal in the eyes of the law and some people. For 17 years homosexuals were not allowed to openly serveRead MoreAbortion : Pro Life And Pro Choice983 Words   |  4 PagesAbortion has been a heated debate in the United States for decades. Since before the ruling on Roe v. Wade, it is clear that this is an issue that is far from ever being dec ided upon. Between those who are pro-life and those who are pro-choice, scholars from both sides work on disproving the morality of the other side. With the evolution of abortion laws and regulation through the decades, it is difficult to imagine the United States without conflict pertaining to abortion. Despite pro-life and pro-choiceRead MoreShould Abortion Be Legalized?1490 Words   |  6 Pages One of the most controversial debates nowadays is whether abortion should be legalized or not. Having used abortion procedures since 1550 BC, which had been accepted in ancient Rome and Greece without any critics regarding to morality, ethicality or religiosity. It has become a main point of public discussion and one of most banned acts in the last century. In the beginning of the 19th century, this technique was advertised as a legal practice in United States. However, in the early 20th an increaseRead MoreTeen Pregnancy : A Social Issue1371 Words   |  6 PagesTeen pregnancy is a ver y controversial social issue and the vast majority of Americans consider the outrageous rate of teen pregnancies a severe issue, certainly a problematic occurrence that is believed to be a moral decline in our country. Teenagers are physiologically capable of reproducing but not emotionally or financially prepared to be parents at such a tender age. Through various research studies a plethora of determinants has pin pointed teens unprecedented pregnancies. One cause of thisRead MoreEssay on Technology Assisted Reproduction3294 Words   |  14 PagesTechnology Assisted Reproduction Introduction Reproduction is fundamental for the perpetuation of a species and therefore is a trait all species possess. Human reproduction is usually not viewed in this context. Extinction of humans is not considered a threat, but the ability to reproduce is an issue of meeting social expectations. Psychologist Dr. Helen Fisher states that society tends to pressure women into feeling that motherhood is their sole connection to being female (Rutter, 1996)Read MoreRole of Ministry of Health in Malaysia6759 Words   |  28 PagesHealth, anybody can make the claim that their product is the best for health; anybody can set up a hospital. Nobody to regulate the quality of the workforce involved the quality of healthcare, and the quality of equipment. So the Ministry of Health has a big role as a regulator and policy maker. The Ministry of Health, being the lead agency in health provides leadership on matters relating to health and also sets the direction for health care development in the country. During the Ninth MalaysiaRead MoreWhen does Personhood Begin and Where do we Draw the Line?1403 Words   |  6 Pages When does Personhood Begin and Where do we Draw the Line? After coming to the United States, the first controversial issue that caught my attention was personhood and abortion. Most of the people that I had conversations with were concerned about this issue and were against the personhood legislation in Oklahoma which prohibits abortion and birth control. Mostly the women viewed the whole issue as an infringement upon their rights. Likewise, the men were concerned about the rights of their lovedRead MoreGender Equality And Gender Inequality2137 Words   |  9 Pagesalways been seen as the subordinate gender. Considered weaker, more emotional, and less intelligent or capable than their male counterparts, women have been trying for decades to overcome adversity and get to a point where they can be taken seriously in a patriarchal world. Though progress has been made, there is still a long way to go until true gender equality is established. In America today, women are still predominantly seen in professions that have been traditionally considered â€Å"women’s work†Read MoreMoral And Legal Implications Of Abortion2159 Words   |  9 Pagesat life? With ceaseless controversy over abortion, it is crucial to take into account both the moral and legal implications. A unborn child’s personhood has a considerable effect on the views of the morality of abortion. Legally, it is critical to consider parental rights and regulations placed on abortion. This contentious debate has been involved in the United State’s history for quite some time. Abortion was practiced until 1880, when it was banned except to save a mother’s life. This legislationRead MorePro Choice And Women s Rights Essay3415 Words   |  14 Pagesconcerning Pro-Choice and Women’s Rights are, un-argumentatively, intertwined, due to its complexity and strong position of defending what is perceived as a basic human right, the right of women to have a choice to reproductive health. Unfortunately, governmental action is delayed and avoids incorporating into policy, the right to reproductive care as a preventive and medical necessity that needs to be covered by health insurances. Pro-Choice legislation is controversial and has divided America into

Versatile and Multiplex Cell Migration

Question: Discuss about the Versatile and Multiplex Cell Migration. Answer: Introduction The wound healing experiments are important in the determination of the patterns in which the cells migrate and interact with one another. When there is a wound, the monolayers of the cells respond to the cell to cell contact disruptions (Elong et al.,2014). This leads to an increase in the number as well as the concentration of the growth factors on the margins of the wound. This process involves the migration of the cells which finally results in the complete healing of the wound. This process therefore demonstrates the manner in which individual as well as layers of cells behave, following a damage to the tissue (Wolf et al., 2013). In this experiment, a healing assay was conducted in an effort to determine the patterns of migration of cells (Gibbs et al., 2013) . The scratch assay is therefore intended to study the process via which re-epithelialization of tissues occur invitro. Confluent PC-3 epithelial cells were grown in a three culture dishes until they reached confluence (100%). Using a 5ml pipet, a continuous scratch was made on the line of cells in order to mimic the development of a wound. Each culture dish was exposed to varying treatment conditions to determine the roles played by microtubules and microfilaments in wound healing. 25ml of dimethylsulfoxide solution was put in the culture media containing the PC- 3 cells to act as the control of this experiment. Before the Paclitaxel and cytochalasin D were added to the cells, DMSO was added to them. Paclitaxel was added to one of the culture dishes at a concentration of 100nM.to the third culture dish, cytochalasin D was added at a concentration of 100nM Upon the establishment of the three treatment conditions, the culture dishes were then incubated for 48 hours to give time of the re-epithelialization to take place. After incubation, each of the culture dishes was fixed using 10% neutral and buffered formalin for preservation purposes. Each of the fixed culture dishes was stained by use of eosin and hematoxylin stains. Re-epithelialization of the wound was monitored over time by observing the migration of the cells. This was measured by measuring the change in the thickness of the wound from the time a wound was introduced to the ultimate healing. The total change in the thickness of the wound was calculated against time. The organization of the microfilaments and was also determined by exposing the cells to varied conditions. To achieve this, the f-actin was labelled fluorosly by use of FITC- conjugated phalloidin. The network of the microfilaments was then observed by use of the fluorescence microscope. It was observed that as time passed by, the epithelial cells within the margin of the wound migrated into the area of the wound. This was in an effort to replace the cells that had been scratched away as a result of tissue injury. Moreover, it was observed that the cells that remained in the margin of the wound underwent increased proliferation to replace the cells that had migrated to the wounded area of the tissues. With time, the thickness of the injured area decreased. The addition of dimethyl sulfoxide as a control in this assay was in order to account for the possibility of any nonspecific effect of this solution on the wound healing. Paclitaxel was added to a different culture dish in order to stabilize the microtubules in the cells by interfering with the division and migration of cells (Cai et al., 2014). The addition of cytochalasin D was in order to find out the roles played by microfilaments in healing of wounds. This is because cytochalasin D blocks the reorganization of microfilaments and hence it affects proliferation and cell migration in a negative way (Kamimura et al., 2015). This experiment or assay clearly gives an indication of the way in which the cells behave upon injury. The healing of the wound occurred in a stereotyped way, that is, the cells polarized in a negative way to the wound area. The polarized cells then initiated the protrusion and migration and finally the wound became closed. The time based microscopy provides an e fficient tool via which the events of cell migration and healing of the wound occurs in a sequential manner. Some of the practical examples of this assay are the proliferation of cells and deposition of the extracellular matrix, and an increase in inflammatory cells. In another approach, this assay is important in explaining the way in which a disease is distributed in the body from an initial infected organ through metastasis. The PC-3 cells were stained in order to increase the contrast during observation under the fluorescent microscope.it is therefore important to consider the methods of staining because some methods can damage the cells being studied. Some staining methods require the dyes to penetrate deep into the cell, something which is not possible in live cells. In order to curb this and make it important to store the stained cells for future reference, fixation, which involves killing of the cells while maintaining their structure and composition is carried out before st aining (Vasicova et al., 2016). Fixation can be done by use of the chemicals like the buffered solution containing formaldehyde. This chemical is known to maintain the integrity and structure of organelles and structure of the cells while at the same time blocking the decomposition of cells by enzymes. Since this chemical is carcinogenic, it needs to be handled with great caution (Kuzmin et al., 2014). The physical methods of fixation involves either drying of freezing of cells. The choice of the fixation methods to be used depends on a number of factors such as types of cells being used and the intention of the experimental set up. In most cases however, the formaldehyde is used for fixation purposes. The preservation of cells using this chemical is made possible through a process which forms cross bridges between the nucleic acids and the amines on the proteins (Andreeva et al., 2016). The eosin and hematolxylin were used for staining purposes to be able to observe the cells in de tails. In the oxidized state, the hematolxylin stain is blue or purple in color and easily binds to the nucleic acids in the nucleus. On the other hand, since the eosin stain is negatively charged, it gets attracted to the amino acids which are negatively charged and found in the cytoplasm and stains pink color. Cell migration in this assay is likely to be inhibited by several cell processes such as the inhibitors of metabolism or translation of proteins (to form amino acids). This assay is therefore important in the determination of the molecules that can be able to inhibit the migration of cells in a wounded area. For instance, if there is an inhibition by the chemical, cytochalasin D, then is possible to get the inhibitors of cell migration. The cell migration refers to an important process which is critical for the development and maintenance of cells in organisms it is important especially during immune responses upon injury, embryonic responses and healing of wounded areas. If an error occurs in the process of cell migration, then there is a possibility of series effects occurring which include development of tumors, intellectual capability and metastasis. When this process is clearly understood, it can be important for the development of novel drugs for instance in the control of invasive cancers. The eukaryotic cell cycle is a series of growth and development which enables cells to move from the birth until they form the mother cell which eventually forms the daughter cells. The stages of cell cycle include the interphase, cytokinesis and mitosis.in the interphase, cells grow in size in G1 phase, synthesize new copies of DNA in S phase and synthesizes organelles and proteins in the G 2 phase. During the mitosis stage, the nuclear DNA condenses to form chromosomes, pulled apart to form spindles (composed of microtubules) in prophase, metaphase, anaphase and telophase phases (Yanagida Pines, 2015). During cytokinesis stage, the cytoplasm of the cell splits into two, forming two daughter cells from one parent cell. In cell division, the microtubules controlled the movement of the chromosomes while the microfilaments forms a contracting ring which splits during cytokinesis to form two daughter cells (Akhshi et al., 2014). References Akhshi, T. K., Wernike, D., Piekny, A. (2014). Microtubules and actin crosstalk in cell migration and division. Cytoskeleton, 71(1), 1-23. Andreeva, N. V., Leonova, O. G., Popenko, V. I., Belyavsky, A. V. (2016). Controlled formaldehyde fixation of fibronectin layers for expansion of mesenchymal stem cells. Analytical Biochemistry, 514, 38-41. Cai, D., Chen, S. C., Prasad, M., He, L., Wang, X., Choesmel-Cadamuro, V., Montell, D. J. (2014). Mechanical feedback through E-cadherin promotes direction sensing during collective cell migration. Cell, 157(5), 1146-1159. Elong Edimo, W. S., Derua, R., Janssens, V., Vanderwinden, J. M., Waelkens, E., Erneux, C. (2014). SHIP2 controls focal adhesion size and affects cell migration in a glioblastoma cell model. Gibbs, S., Spiekstra, S., Corsini, E., McLeod, J., Reinders, J. (2013). Dendritic cell migration assay: a potential prediction model for identification of contact allergens. Toxicology in vitro, 27(3), 1170-1179. Kamimura, M., Scheideler, O., Shimizu, Y., Yamamoto, S., Yamaguchi, K., Nakanishi, J. (2015). Facile preparation of a photoactivatable surface on a 96-well plate: a versatile and multiplex cell migration assay platform. Physical Chemistry Chemical Physics, 17(21), 14159-14167. Kuzmin, A. N., Pliss, A., Prasad, P. N. (2014). Changes in biomolecular profile in a single nucleolus during cell fixation. Analytical chemistry, 86(21), 10909-10916. Vasicova, P., Rinnerthaler, M., Haskova, D., Novakova, L., Malcova, I., Breitenbach, M., Hasek, J. (2016). Formaldehyde fixation is detrimental to actin cables in glucose-depleted S. cerevisiae cells. Microbial Cell, 3(5), 206-214. Wolf, K., Te Lindert, M., Krause, M., Alexander, S., Te Riet, J., Willis, A. L. Friedl, P. (2013). Physical limits of cell migration: control by ECM space and nuclear deformation and tuning by proteolysis and traction force. J Cell Biol, 201(7), 1069-1084. Yanagida, M., Pines, J. (Eds.). (2015). Mitosis. Cold Spring Harbor Laboratory Press.

Financial System of China Free-Samples for Students- Myassignment

Question: What is Shadow Banking ? Does it pose a threat to the stability of China's Financial System? Answer: Introduction The term shadow banking is not new, however, it came into large use only recently and there is no particular definition for the term. The Financial Stability Board (FSB) widely described the term as the intermediation of credit that involves the activities and the organizations outside regular banking system. The Peoples bank of China (PBOC) utilizes the definition of the term shadow banking that demands to take particulars on their own national situation under the full account. Whatever be the definition, the shadow banks undertakes the same tasks and presumes the same risks as the banks, for instance, the activities associated with credit, maturity and the transformation of liquidity (Lardy 2013). Te definition of shadow banking is exposed to practical difficulties with regard to its precise definition as well as the usefulness for explaining the real world. Further, it is not easy to draw the borders among those activities and institutions that are guaranteed by and not guaranteed by the governments (Elliott, Douglas, Arthur Kroeber, and Yu Qiao 2013). Decoding shadow banking from the Financial Stability Board The system of shadow banking attracted much attention before global financial crisis that started during 2007. However, it became one of the root causes for the worst depression in the financial depression. There are two methods that explain the causes for the financial crisis. As per the theory of global saving glut, it is the high savings that influenced the flow of money from the emerging market economies and assisted in pushing the interest rate on the long run to be down to the bottom level. Further, the Financial Stability Board (FSB) indicated that during 2002 to 2007, the system of shadow banking increased to US$33 trillion and the size of the assets doubled from US$27 trillion to US$67 trillion. The shadow banking is considerable increasing over the past years not only in China but in the other parts of the world and the IMF has advised that the Shadow banking sector of China shall be monitored appropriately (Lu, Yunlin, Haifeng Guo, Erin H. Kao, and Hung-Gay Fung 2015). Causes of rapid growth in shadow banking There are various causes that attributed to the rapid growth of shadow banking after the financial crisis. They are Increasing of the interconnectedness and financial deregulation: the procedures of deregulation experienced the shadow financial institutions, for instance, NBFCs are becoming much more interconnected with the other sectors of financial system and much more complex with regard to the risk-taking approaches and activities. Thus, they are becoming more vulnerable with regard to other financial markets that increase the systematic risk (Elliott, Douglas J., and Yu Qiao 2015). Financial exclusion: the small personal businesses and the SMEs find it costly and difficult for accessing the credit from the formal bank and the gap is filled by the NBFCs. The poor people are denied the load owing to low income, lack of sufficient collateral and the possibilities of default. However, the microfinance offers easy access to the funds to the self-employed and the poor people at high interest rate. As the poor have no other options, they avail the loan with higher rate of interest only (Riasi, Arash 2015). Functions of China Banking Regulatory Commission Formulation of the regulations and the supervisory rules that governs the banking institutions Responsibilities of the supervisory boards administration for the major banking institutions owned by the state and the other activities that are delegated by state council (Ueda, Kenji, and Yuko Gomi 2015) Authorize the changes, termination, business scope and the establishment for the banking institutions. Conduct the fit and proper tests for the senior management under the banking institutions (Hsu, Sara, and Jianjun Li 2015). Publish and compile the reports and statistic of the overall industry of banking as per the required regulations. Provide the proposals related to the resolution related to the issues of the deposit-taking institution with regard to the required regulations Conduct the off-site surveillance and on-site examinations for banking institutions and taking into considerations the enforcement actions against the rule-breaking behaviours (Hsu, Sara 2017). Growth of shadow banking in Chinas financial system Some people from China believe that the shadow financing over China is the banking reform that has gone wrong. The shadow banking is a sign that the banks are circumventing the regulations with regard to increase or at least protect the margin of profit. However, as per the critics, this led to the possibilities of high amount for the bad debts on the bank books. As the Chinese government accounts the banking as as the strategic industry, this issue is quite bigger. In the true sense, the shadow banking is not actually banking as it includes all types of investment products that include private equity and mutual funds. The term shadow banking sometimes called as the loan from bank in disguise (Huang, Robin Hui 2015). As per the G20s financial stability board 2015, Chinas shadow banking was approximately 26% of the GDP during 2014 that was much lower as compared to the 59% average of other countries. Therefore, the most important and interesting development in China was the growth of the trusts. These trusts are the major form of equity investment and listed assets like money market and loans. Thus, they offer the banks to provide finance to the higher-risk areas that are generally restricted as per the general regulations. Owing to the shadow banking, some of the products related to wealth-management were significantly successful and offered exceptional returns to the investors (Dang, Tri Vi, Honglin Wang, and Aidan Yao 2014). Further, the corporate sector may have to sit on the level of high-debt and the leverage under the household and government sectors is lower as compared to various developed countries. As the frameworks involves various factors like high probability of exceptional price volatility, trade barriers, liquidity, exchange controls and the associated risks with the emerging markets, the frontier markets are magnified. Further, due to the shadow banking, the prices of the stocks will be fluctuates dramatically and rapidly which in turn will have impact on individual organizations, sectors, general market conditions and the specific industries (Zou, Xiao-Peng, Yu-Xiao Pang, and Hui-Lin Zhu 2013). The financial risk among the regulated financial intermediation and the shadow banking The tightening of the regulatory system of China is targeted for reducing the leverage in the financial segment, particularly the assets that are funded through the wealth management products. However, this may direct to unintended consequences for higher risk in activities of other shadow banking in shifting the composition of banking sector, as per the analysts. Peoples bank of china raised the rates of short-term policy twice during the year and developed tougher the assessment based on the macro-prudential for the financial institutions. The regulatory commission of China banking is also taking steps for curbing the risks of the products related to the wealth management and the online lending, guarantee chains of the borrower and the trusts. Borrowers in the division of property, financer of industries and vehicles that are burdened by the overcapacity face that are reduced by the access to the loan of the international bank and the market for the domestic bond (Wang, Hao, Hongli n Wang, Lisheng Wang, and Hao Zhou 2016). SWOT analysis Strength The main strength of the shadow banking is that the system of shadow banking does not require any regulation. As there are so many regulations in association with the bank, this is the biggest advantage that can offset various associated disadvantages. No regulation required for raising the money through selling of the securities that allows the shadow banking to manage as much as risks possible without defeating the obligations. Reports and compliance procedures that can cost million dollars and disruption of the operation are no more required. Weaknesses Shadow banking is not supported by central bank. Therefore, they do not have any back-up that can protect them against the issues if the depositors withdraw their cash all of a sudden. Though the commercial banks indirectly back them up, however, it is quite tough to them for diverting cash into the shadow arm, especially during the crisis period. Opportunities lending provided by the asset managers is the crucial aspect for the effective capital market as the provision of additional credit are crucial to the borrowers, particularly during the distress period of the commercial banking. Further, the private equity funds, hedge funds and other funds will provide loan to the higher risk associated business, for instance, the start-up organizations. However, decisions for lending is usually taken after due diligence with regard to greater flexibilities. Threats the benefits from financed fund have its own costs as the asset managers face the risks associated with the regulatory structures and the operation of the assets. Shadow banking are exposed to various risks that may not have an impact on the conventional large banks. The main threats are as follows: Credit risk an due diligence e. while lending loan to the borrower, the procedures for assessing the credit risk of the borrower accurately, it requires complete disclosures and gatherings of the financial information of the borrower and availability of all the information may not be always available Liquidity risk shares from the ETFs and the open-ended mutual funds are generally tradable and redeemable whereas the invested assets are less liquid. Thus, easy liquidity and redemption options are not easy (Tsai, Kellee 2015). Threats to Chinas highly geared financial system In last decades, China witnessed the boom under the shadow finance, specifically with regard to the entrusted loans. The banks use the shadow credit purchase in big size for circumventing the policy restrictions and the regulations related to bank loan. Proliferation of the shadow credit products and the increasing dependency on the wholesale and short-term funding could lead to the substantial risks with regard to the solvency of the borrower and the default of the corporate loan. Further, the risk related to stability may include under the potential risk for the defaults on the largely held shadow products with regard to the short-term investments associated with high-risk borrowers (Claessens, Stijn, and Lev Ratnovski 2015). Governments reform to mitigate the threats Government of China has taken various reforms for mitigating the threats associated with shadow banking. These are Peer to peer banking the non bank capital raised from various sources that involves trust firms, brokerage firms, insurance firms and the platform for the peer to peer lending. These sources are lend to the stock investors through various innovative channels like offline private fund that matches with the organizations and structured organizations for the mutual funds. Further, one of the most significant developments throughout the stock market bubble is the business related to the matching business of online fund. The peer to peer platform of lending enables the match funding organizations to attract the huge individual lenders which in turn enables the mobilizing of large capital into stock market during the short time period (Li, Jianjun, Sara Hsu, and Yanzhi Qin 2014). Underground banking system under the underground banking system the money is transferred through the informal banking instead of the the formal banking and is recognized through the method that legitimately remitted from oversees workers that are transferred. However, the underground banking are regarded as the channel for money laundering and it is crucial for achieving the balance among regulation of the underground banking to decrease the flow of the illicit funds and giving permissions for the continuous usage of the alternative, legitimate remittance system (Li, Tong 2014). Conclusions It has been concluded from the above discussion that the financial system of China has shifted from the isolated, heavily regulated and bank-dominated system into the increasingly diversified, large and interconnected system. The transformation is developed the efficiencies of financial system and are expected to get benefits for the economic development over the short-term period. This is particularly exists while the financial systems are under excessive pressures from competition to expand them into the riskier market for the assets and the developed regulatory framework is not been kept in pace with the changes. However, the crucial question regarding this is is whether the coordinated arrangements that appeared to be efficient during crisis are equally suited with the normal condition sof operations References Claessens, Stijn, and Lev Ratnovski. "What is shadow banking?." (2015). Dang, Tri Vi, Honglin Wang, and Aidan Yao. "Chinese shadow banking: Bank-centric misperceptions." (2014). Elliott, Douglas J., and Yu Qiao. "Reforming Shadow Banking in China."Economic Studies at Brooking. Available at: https://www. brookings. edu/~/media/research/files/papers/2015/05/12-reforming-shadow-banking-china/elliott--shadow-banking. pdf(2015). Elliott, Douglas, Arthur Kroeber, and Yu Qiao. "Shadow banking in China: A primer."Research paper, The Brookings Institution(2015). Hsu, Sara, and Jianjun Li. "The rise and fall of shadow banking in china."Political Economy Research Institute, Working Paper Series Number375 (2015). Hsu, Sara. "Shadow Banking in China Shen Wei Northampton, MA: Edward Elgar, 2016 xiv+ 455 pp. $175.00 ISBN 978-1-78471-676-9."The China Quarterly229 (2017): 232-233. Huang, Robin Hui. "The regulation of shadow banking in China: International and comparative perspectives."Banking Finance Law Review30, no. 3 (2015): 481. Lardy, N. "Shadow Banking in China." InPresentation at the Chicago Feds Sixteenth Annual International Banking Conference. 2013. Li, Jianjun, Sara Hsu, and Yanzhi Qin. "Shadow banking in China: Institutional risks."China Economic Review31 (2014): 119-129. Li, Tong. "Shadow banking in China: expanding scale, evolving structure."Journal of Financial Economic Policy6, no. 3 (2014): 198-211. Lu, Yunlin, Haifeng Guo, Erin H. Kao, and Hung-Gay Fung. "Shadow banking and firm financing in China."International Review of Economics Finance36 (2015): 40-53. Riasi, Arash. "Competitive advantages of shadow banking industry: An analysis using Porter diamond model."Business Management and Strategy6, no. 2 (2015): 15-27. Tsai, Kellee S. "The political economy of state capitalism and shadow banking in China." (2015). Ueda, Kenji, and Yuko Gomi. "Shadow Banking in China and Expanding debts of Local Governments."Newsletter23 (2013). Wang, Hao, Honglin Wang, Lisheng Wang, and Hao Zhou. "Shadow banking: China's dual-track interest rate liberalization." (2016). Zou, Xiao-Peng, Yu-Xiao Pang, and Hui-Lin Zhu. "The study between shadow banking and financial fragility in China: an empirical analysis based on the co-integration test and error correction model."Quality Qua

White Noise The invasion of Consumerism in a PostM Essay Example For Students

White Noise The invasion of Consumerism in a PostM Essay odern Family The Invasion of Consumerism into the lives of a Post-Modern Family Consumerism is taking place everywhere. Whether we like it or not, it has come to invade our everyday modern lives. Steven Miles, a lecturer in sociology at the University of Plymouth says How we consume, why we consume, and the parameters laid down for us within which we consume have become increasingly significant influences on how we construct our everyday lives (1). Consumerism has even gotten to the point of affecting the way we go about living and controlling our personal and social lives (Miles 5). Wherever we go and whatever we do, consumerism is praised as the answer to all of our problems, an escape from some of the harsh realities of our lives. We will write a custom essay on White Noise The invasion of Consumerism in a PostM specifically for you for only $16.38 $13.9/page Order now Don DeLillos White Noise depicts the different aspects of consumerism and the effects it has post-modern family that it invades. That specific family is the Gladneys from Blacksmith. For the Gladney family, Jack, Babette, Heinrich, Steffie, Denise, and Wilder, consumerism is a way of life. It is something they are always taking part in, even if it is unconsciously. Consumerism is incorporated in with virtually every activity the family takes part in, whether it be eating out, spending a day together at the shopping mall, or making a quick stop at the supermarket. Jack Gladney is a patron of supermarkets and shopping malls (McInerney 36). Jack alone, but more frequently with the company of one or more family members, makes trips to the supermarket. The supermarket has come to be a major point of intersection in todays culture (Conroy 97). Among the busy and bustling crowds of people, Jack often runs into acquaintances, most commonly a colleague from The College on The Hill, Murray Jay Siskind: The two girls and Babette, Wilder and I went to the supermarket. Minutes after we entered, we ran into Murray. This was the fourth or fifth time Id seen him in the supermarket, which was roughly the number of times Id seen him on campus. (35) Even Jacks daughter, Denise, runs into a group of friends during one shopping trip. They all gather together to look at books and talk. Jack also has many significant conversations with Murray while casually strolling up and down the aisles of the supermarket. On one such occasion, Murray tells Jack how happy he is to be in Blacksmith, in the supermarket, in the rooming house, on the Hill (36). He continues to say I feel I am learning important things every day. Death, disease, afterlife, outerspace. Its all much clearer here. I can think and see (36). With Murray expressing his feelings to Jack, it is almost as if these encounters at the supermarket are replacing customary Aside from being a meeting grounds, the supermarket is filled with many consumer goods conveniently in bulk. Jack describes this in one of his many trips to the There were six kinds of apples, there were exotic melons in several pastels. Everything seemed to be in season, This kind of abundance of goods is seen in just about everywhere. Ten years ago, most supermarkets stocked about nine thousand items and now todays stores carry over 24 thousand (Wolkormir). Most of these items come from a can or box and can be cooked in the microwave or require no cooking at all. This explains why the number of hours parents spend cooking is going down at an increasingly rapid rate and why McDonalds so proudly displays outside their restaurants, Over 1 Billion Served. Fast food restaurants play a big role in todays growing consumerism. Americans enjoy more restaurant prepared food than ever before. Carrie Reynolds, a fast food restaurant consultant says, we eat out today more because it fits our high-speed, consumer-mad lifestyles(qtd. in Silver 42). Almost half of every dollar spent in 1999 was spent eating out, and that figure is expected to up 53% by 2010 (Silver 40). .ue0e82041934b2498d1d0730774fd226b , .ue0e82041934b2498d1d0730774fd226b .postImageUrl , .ue0e82041934b2498d1d0730774fd226b .centered-text-area { min-height: 80px; position: relative; } .ue0e82041934b2498d1d0730774fd226b , .ue0e82041934b2498d1d0730774fd226b:hover , .ue0e82041934b2498d1d0730774fd226b:visited , .ue0e82041934b2498d1d0730774fd226b:active { border:0!important; } .ue0e82041934b2498d1d0730774fd226b .clearfix:after { content: ""; display: table; clear: both; } .ue0e82041934b2498d1d0730774fd226b { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .ue0e82041934b2498d1d0730774fd226b:active , .ue0e82041934b2498d1d0730774fd226b:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .ue0e82041934b2498d1d0730774fd226b .centered-text-area { width: 100%; position: relative ; } .ue0e82041934b2498d1d0730774fd226b .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .ue0e82041934b2498d1d0730774fd226b .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .ue0e82041934b2498d1d0730774fd226b .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .ue0e82041934b2498d1d0730774fd226b:hover .ctaButton { background-color: #34495E!important; } .ue0e82041934b2498d1d0730774fd226b .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .ue0e82041934b2498d1d0730774fd226b .ue0e82041934b2498d1d0730774fd226b-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .ue0e82041934b2498d1d0730774fd226b:after { content: ""; display: block; clear: both; } READ: Essay on Poverty And Its Effects On America Essay The Gladneys are seen eating restaurant prepared food frequently, whether it be Chinese take-out night or dinner in a car outside of a commercial strip of fast food restaurants. This is common for families, especially because it is convenient for the parents busy schedules. Fast food may be convenient and seems great at the time, but in the long run, can eventually kill. One in five children between the ages of six and seventeen is overweight and if current trends continue, nearly half of todays .

buy custom The New Immigration Law essay

buy custom The New Immigration Law essay Immigration law is a government policy that checks the movement of people in a particular country. Immigration laws govern the legal status of foreigners in matters like citizenship. These laws vary from one country to another and are determined by the political climate of a country and its state of security. Some nations maintain strict immigration laws, which are aimed at controlling the rights of entry and internal rights; for instance, the right to contribute in the affairs of a government, as well as duration of visit. A majority of nations have laws which select a process for naturalizing immigrants (Archibold). For example, the United States permits over one million foreigners every year to become its lawful permanent residents, making it the leading nation in the world to receive such a large number of people. Illegal immigration began in the U.S. in 1920s and emerged to be a huge crisis in the 1980s. In 1875, a state law was passed that forbade the entry of prostitutes and criminals in the U.S. The law may have affected very few immigrants, but it marked the beginning of the division between legal and illegal immigrants. The largest immigration wave was witnessed between 1881 and 1920, in which 23.5 million immigrants entered the U.S. from various parts of the world (Archibold). Since then, people from all over the world have continued to travel to the U.S. to look for better opportunities in education, employment etc. However, after the 9/11 attack, immigration law in the United States became a very serious matter, and as a result, numerous immigration laws were enacted to control unlawful immigration (Archibold). This paper discusses the controversial new Arizona immigration law, the different reactions from its supporters and critics, as well as my opinion on the issue. In April 2010, the Arizona Immigration Law (Law SB1070) took effect in Arizona State in the United States. The law, which was seen as the toughest immigration law in the history of the U.S., provoked a national debate with some people strongly opposing the law, while others supporting it (Reuters). According to SB1070, it is a criminal offense to harbor illegal immigrants; it also requires immigrants to carry their documents wherever they go. The law gives police officers the power to stop and ask persons about their immigration status when there is a reasonable suspicion that a person is in the U.S. illegally, in the course of their traffic stops, or other actions aimed at enforcing the law (Archibold). The number of illegal immigrants in Arizona is estimated to be 460,000, and with the tough immigration law in place, it seems they have no choice but to return home. SB1070 is not only important because it involves the people of Arizona, but also because it affects the relationship of the U.S. with other countries, and consequently, its economy. Critics maintain that the law is discriminatory, targeting only Mexicans, and encourages racism and harassment of immigrants by the police (Archibold). Their arguments are backed by community activists who think that the new law will make documented immigrants in Arizona to dread dealing with police officers for fear of being harassed. No immigrant, whether documented or not, would want to call for police intervention, even when faced with serious security matters. There have been reports that documented immigrants are running away from Arizona because they fear undergoing racial profiling. Supporters of the new immigration law, however, are saying that it will reduce crime in Arizona and create more employment opportunities for the citizens of America (Archibold). My opinion is that the safety of Arizona people and the U.S. as a whole should be given priority, and therefore, this law is intended to enforce security and reduce crimes in Arizona. Even those Mexicans that, as critics claim, are targeted by this immigration law also need to be safe while walking on the streets of Arizona. I totally agree with the supporters of this law. As much as the law might seem harsh on illegal immigrants, the security and the needs of the Arizona people come first. Giving aliens the opportunity to work in Arizona to better their lives is a good thing, but allowing them to enter and stay in the U.S. illegally is very risky, since not all immigrants have good intentions. On the other hand, not all unlawful immigrants are bad, and therefore, they should not be blamed for the violence that is happening in Arizona (Beard). But the fact still remains that the U.S. is among the most powerful nations in the world, and it cannot take for granted its national security, especially after the 9/11 attack, and that is why Arizona State is not taking chances with the security of its people. Seemingly, the Obama administration is more concerned with revival of the U.S. economy and does not give more priority to immigration laws; therefore the Arizona legislature was right in passing the law to protect the Arizona state from its high crime rate. The new Arizona Immigration Law is a controversial topic that has divided people in the U.S. into two distinct groups: with one group supporting the law, while the other opposing it. Supporters argue that there has been increased violence in the border regions of Arizona, as evident by the killing of Robert Krentz, a Cochise County rancher, close to a Mexican border by a drug smuggler (Wagner). In addition, two police officers based in Phoenix were murdered by illegal immigrants in 2007, and in 2010, a deputy sheriff was injured in a gun battle by males that were alleged to be drug smugglers from Mexico City. These incidents increased a negative public perception of Arizona, with the national media depicting the region as a border for bloodshed (Wagner). The proponents of SB 1070 have cited rates of incarceration, as an indication that undocumented immigrants are contributing to the high crime rate in Arizona. Varying statistics have been reported on the number of imprisoned illegal immigrants. For instance, Jack Harris, the Phoenix Police Chief, stated that illegal immigrants constitute 10% of the arrests in his department; a number that is near to the percentage of unlawful immigrants in the U.S. Statistics from Maricopa County sheriff's office (it runs prison for Phoenix and neighboring cities), however, reported that undocumented immigrants constitute 20% of its inmates (Wagner). Proponents of the law are strongly convinced that criminals from Mexico are increasingly entering the U.S. via Arizona, thus increasing insecurity in the country. However, according to the sheriff of Pima County, Dupnik, the insecurity issue at the Arizona border was a media creation. In fact, he said that the border is more secure now than before (Wagner). Dupniks opinion was confirmed by the recent study, which found out that the numbers of immigrants who engage in crime in Arizona are fewer compared to nationals of the state. Since the 1990s when illegal immigrants began pouring in Arizona, there has been a general decrease in crime in the state; for instance, in 1995, the rate of property crimes reduced to 43%. Some critics of the Arizona immigration law are in agreement with their counterparts who support the law with regards to illegal immigrants committing fewer crimes. Nonetheless, they maintain that public safety is their main drive for supporting the law. The executive director of the Arizona Police Assn., Mr. Brian Livingston, who was previously opposed to the law, said that he changed his mind, following complaints from a Latina that illegal immigrants engaging in criminal activities in her neighborhood were not being arrested. Though he admitted that illegal immigrants come to the U.S. for a good course (seeking better life or fleeing violence in Mexico), he was quick to point out that there are criminal elements among immigrants, and they are the main target of the new law i.e. the smugglers who prey good people from Mexico (Wagner). Currently, Phoenix has developed into a center of human trafficking, and its escalating crime rate is similar to other main cities in Mexico. Over 240 cases of kidnapping and human smuggling were reported in Phoenix in 2008 alone. This shows just how insecure the state of Arizona is, and only the enforcement of a stringent law, such as the SB1070, will help bring safety to the state, and the U.S. in general (Archibold). It has been reported that illegal immigrants in Arizona sell grenades in the black market. However, Jack Harris, the Phoenix Police Chief, disagreed with this report saying that the criminality of illegal immigrants in Arizona was being exaggerated. Harris refuted the notion that getting rid of illegal immigrants will lead to a significant reduction in crime in Arizona, dismissing the argument as a political opportunism (Archibold). Civil rights activist groups, such as the American Civil Liberties Union, termed the new Arizona immigration law unconstitutional. Other people who have joined in the protests against the new Arizona immigration laws are music celebrities such as Lady Gaga, who, while addressing a gathering at the U.S. Airways Center, said that she would join hands with others to hold a peaceful protest against the law (Sacks). Even President Obama said that the law is misguided, promising that it will be looked into by the Justice Department. He said that the fact that the law necessitates aliens to carry their documents wherever they go puts them at risk of being harassed by the police, and that is not the right approach to tackling insecurity issues in the U.S. I totally disagree with those who oppose this law, who have maintained that the law is inhuman and encourages racism. I still maintain that the law is well-intentioned and is meant to protect the Arizona people from insecurity risks. It is important to note that other nations in the world have similar documentation prerequisites as Arizona. What Arizona did was merely adding a state punishment to what is already a state crime in the U.S. It has been a crime ffor foreigners in the U.S. to fail to keep their documents with them; therefore, the Arizona immigration law is nothing new; it is just an enforcement of the existing immigration law. In addition, some people argue that the law encourages racial profiling. According to Lourdes Medrano, an opponent of the law, racial profiling is illegal not only in the U.S., but also in Arizona (Archibold). He argues that the law permits police officials to stop and ask persons about their immigration status when there is a reasonable suspicion t hat a person is in the U.S. illegally, and he wonders what criteria the police would use in their assessment to determine who is an illegal immigrant. He maintains that not every illegal immigrant in the U.S. is involved in criminal activities, and that they greatly contribute to the development of the U.S. economy, and sending them away will negatively impact on the U.S. economy. This is because the jobs the illegal immigrants do are those rejected by the American citizens, yet they are very important to the U.S. economy (Archibold). I do not agree with the argument that the law encourages racial profiling; in fact, Section 2 of the Arizona Immigration law clearly states that the police cannot exclusively consider color, race or nationality to determine the immigration status of people, or to make traffic stops. Therefore, I think that this law actually prevents racial harassment by the police, because it requires officers to get in touch with the federal government immediately when they suspect that a person is illegally in the U.S., rather than arresting them based on their own evaluation (Spakovsky). Some critics of the law argue that it is unfair for the law to demand that aliens carry their driving license wherever they go. This claim is not true; the Arizona immigration law does not require anyone to carry a drivers license, be it a U.S. national or an alien. Since, only legal residents of Arizona are given licenses, a police officer assumes that a foreigner with a driving license is legally in the U.S., and therefore, he or she is given a free pass at stop points, regardless of their immigration status (Archibold). Though critics claim that the law is unconstitutional since immigration is a responsibility of the federal government, and that Arizona State has no mandate to enforce such a law, I totally disagree. I admit that Washington DC hold the key authority when it comes to matters of immigration, but it is also important to note that since 1976, the U.S. Supreme Court has recognized that the federal law should not prevent states from ratifying laws that are aimed at discouraging unlawful immigration. As long as the U.S. Congress has not outlawed this statute, then Arizona is right to implement such a law. That is why the U.S. Court of Appeal (Ninth Circuit) sustained the Arizona law in 2007, which made it unlawful to intentionally employ unauthorized foreigners in Arizona (Archibold). Supporters of the Arizona immigration law say that the law tackles the immigration issue better when compared to the federal government. According to statistics by the U.S. Border Patrol, close to 50% of seizures of illegal immigrants take place in Arizona. President Obama said in the recent past that his government will focus on illegal immigrants engaged in criminal activities, and that it is the responsibility of the Department of Justice to handle immigration, as opposed to state governments (Markon). My question is: what if the Department of Justice is reluctant in carrying out its duty, will the individual states faced with high crime rates such as Arizona sit back and do nothing? Certainly not, that is why I support the new immigration law. Arizona State is simply taking responsibility for its peoples welfare and security. Immigration law in any country is intended to govern the migration of people. In an attempt to seek for greener pastures, foreigners go to nations deemed to have better opportunities either by legal means or illegally. Increased insecurity issues especially the 9/11 attack, led the U.S. Government to enact stringent immigration laws to check the legal status of immigrants. Arizona State, especially Phoenix, has grown to be a hub for illegal immigration, and consequently, crime rates in that city have increased tremendously (Archibold). In response to the growing insecurity and crime, the Arizona legislature enacted the Arizona immigration law, a law which provoked varied opinions from the public. While critics maintain that the law is discriminatory and encourages racism, its supporters argue that the law will ensure public safety. I absolutely support the law, because public safety should be a priority of any caring nation. But since the Obama administration is more concerned with r eviving the U.S. economy at the expense of insecurity caused by illegal immigrants, the Arizona legislature was right to enact the law to get rid of the illegal immigrants, who have been associated with the increased crime rate in that state. Buy custom The New Immigration Law essay

Respond Essay Example | Topics and Well Written Essays - 500 words

Respond - Essay Example ary audience for the presentations of Davis & Shadle are the college students and the main concern drawn is the essence of the research writing as an exposure to a broad body of knowledge and personal development that comprise of the perception view and understanding of the world and the cognitive levels. Importantly, the method of starting the students in the research journey is the exposure to the published texts that initiates the motion and rest on the zones of the subject, forms and the culture, (Davis & Shadle 55). Davis and Shadle raises the concern and the importance of the research writing in the college academic progress, the grievances are presented to the students, the extent to which the research contributes to the intellectual development of a student at the college level. The presentations of the multi-genre, the multimedia text depicts how the travelers learn through under the curiosity and friendliness, (Davis & Shadle 55-56). Davis and Shadle assess the multiple disclosures to all the subject areas of interest and subject the college students to follow to the destination. The examples depict and illustrate emphasizes the form of suggesting that the culture only makes sense in the horizon of forms, appearance, values and appearance of the real world of that surrounds the students. The inquiry are based on the appreciation of the familiar as well as the problematic daily lives that are aimed at the fulfillment of the process of transformation while the topics of the research remains to be of inquisitive critique all round, ( Davis & Shadle 58-59). They advocate that the students to carry out research on the topical issues that are prone to the criticism to which the facts are developed. Davis and Shadle argue that the primary concern and the reason for Research narrow down to the level of the knowledge acquired by the individual student in the academic progress at the college level. Further, the emphasis is given to time and history that forms the

What would you do as an educator to make spanish speakers (parents and Assignment

What would you do as an educator to make spanish speakers (parents and students) feel comfortable when they meet you in a school setting - Assignment Example onal domains that are being instilled in them and hence it would be a point of advantage to take into consideration their grey areas and highlight the shortcomings for their own betterment in the long run. I believe I would do them a great service if I look after their needs and requirements and then devise a way which could eventually take care of their learning mechanisms in the long term scheme of things (Goff 2003). This would facilitate them in their quest to achieve greater things within the fields of education and learning. I would also devise the exact ways and means through which they could be assisted in the most feasible manner as far as their learning methodologies and mechanisms are related. These elements are indeed significant as these dictate the kind of optimism that is needed on the part of an educator which I have to take care of at the end of the

The Search for Identity Essay Example | Topics and Well Written Essays - 750 words

The Search for Identity - Essay Example Hence, it must be inherent for a human to search for his or her own identity all throughout his or her existence on earth. In regard to the aforementioned facts, this paper aims to dissect and explicate the search for identity in the two novels namely "Their Eyes Were Watching God" by Zora Neale Hurston and "Run With The Horsemen" by Ferrol Sams. Moreover, quotes from the said novels shall also be cited as well as to determine how it can be a conscious and, at the same time, an unconscious process, thus exemplifying the essence of this essay. Janie Mae Crawford is the protagonist in this novel. Aside from her quest for true love and standing up for her rights, despite the hindrances caused by the seemingly double jeopardy of being a woman and a black citizen- both symbolized an undeniable societal inferiority, she also has a search to find her real identity, that is, who she really is and what she is standing for. Janie's search for her identity is but a conscious effort. She knew what she really wanted: she wanted to be free! At first, she was seemingly under the control of the values that Nanny, her grandmother, has instilled in her young mind, thereby submitting herself to marry a man whom she doesn't even love. Nevertheless, her efforts to set herself free can be seen in as early as the beginning chapters of the novel, particularly when she left Logan to go with Jody. Moreover, when her relationship with Jody was "on the rocks", she has an intense desire to be free from Jody's tyranny. Eventually, after Jody's death, she has won her price of liberty. In addition, after her third husband's (Tea Cake) death, she has definitely liberated herself from all the bondage entanglements in her life. The following quotations are the salient evidences wherein Janie consciously and successfully found her identity: 1. "Now that she is alone, she begins to examine her feelings and realizes that she hates Nanny for the values with which Nanny raised her" (ch. 9). Rationale/Analysis: She was able to identify her own values as distinct from that of her grandmother's, as a result of her experiences. 2. "She looks in a mirror and sees that she has aged but is still beautiful. She rips off her head-rag, freeing her imprisoned hair..." (ch. 8). Rationale/Analysis: Soon after Jody's death, she realized her worth and her new-found freedom through this symbolic act. 3. "[As she] trudges down the main road they envy her physical beauty, particularly her long, straight hair.... [but] she doesn't stop to talk to them" (ch. 1). Rationale/Analysis: This line from the story is actually the ending part, that is, the novel is just set to do a flashback. In this scenario, Janie was walking at the road in a carefree manner. After all that had happened, she has already found her true identity and therefore, she did not bother to care about what other people will think about her because she has now emerged as a confident and an empowered woman with a unique identity. The Search for identity as seen in "Run With The Horsemen" As Porter "Sambo" Osborne Jr., the protagonist in the story, sails his journey through adolescence, his search for identity can be regarded as a natural phenomenon. This is especially true in the developmental stage where he is into. According to Erik Erikson, a renowned developmental theorist whose works are constantly cited by

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

Seeing Through the Grey Mist of Cal Poly :: Descriptive Essays

Seeing Through the Grey Mist of Cal Poly On an early Monday morning my sleepy classmates and I met at the gate to Poly Canyon. The thick marine layer circled around our group as our professor led us into the dense grey fog. A crisp breeze stung my bare cheeks sending a chill down my body. We walked past the Cerro Vista apartments, the last buildings of Cal Poly that I would see for two hours. A feeling of excitement ran through me as we began our walk down the service road and into the canyon, a place just down the street from my dorm that I had never known existed. As we trekked deeper in to the thick mist, a hidden part of Cal Poly began to reveal itself. Walls of serpentine rock rose on either side of the road and the creek below began to fill with water. Four does and a buck looked down on us from the steep slopes above. Eucalyptus trees sent a sweet fragrance through the air, and chirping birds provided soft background music for the hike. Worries of school began to fade away. The trail got rough as we started climbing up Poly Mountain. My eyes were glued to the ground. Rocks were constantly sliding under foot waiting for an opportunity to take my feet out from under me. My breath was getting shorter and my legs began to burn from the first real exercise they had gotten since leaving home. I did not know if I was going to make it up the hill. When we finally stopped for our first break, I collapsed onto the nearest rock and took some time to observe the land around me. I realized I had not looked up once throughout the first quarter of the hike. When we sat down to write I had nothing to describe or to meditate on. The thick fog had erased the trail behind us and everything surrounding it. I was filled with regret. As we continued, I made certain to look around more often. Golden grasses, patches of yucca, grand rock formations, and a solitary tree dotted the landscape. We took our second break in a community of yucca. When I sat down, one stabbed me in my thigh. Its green leaves sat motionless as though nothing had happened.

St. Quiteria Essay

St. Quiteria John 15:13 â€Å"Greater love has no one than this, that he lay down his life for his friends. † Are you willing to lay down for your life for your brothers and sisters in Christ? St. Quiteria and her sisters were not afraid to risk their lives to free Christians and wage war to stop others from being persecuted. St. Quiteria was born in the 2nd century in the city of Minho, Portugal to a mother that had nine daughters and was discussed by this.The mother had ordered the maid to kill her children but she disobeyed and sent them to a nearby village where they grew up and became good Christians. At this time in the 2nd century many Christians were being persecuted and many killed for their religions beliefs by Roman rule. In the 2nd century Rome ruled almost all of Europe and part of the Middle East. Later in life St. Quiteria and her sisters were brought before their father, who wanted them to marry Roman officials. They refused, which enraged their father who impr isoned them in a town.The sisters eventually broke out of the tower and freed all the persecuted Christians inside. Then waged a guerilla war against the Romans. St. Quiteria and her sisters were later caught and executed. I believe we need more people like St. Quiteria still today to fight persecutions here in America and other countries. I believe people should stick up for others who are being bullied and persecuted. I believe we need to fight for what we believe in and not let others fight us and do nothing about it.

Inspirational Quotes for Thanksgiving

Inspirational Quotes for Thanksgiving Imagine a nation where people did not bother to express gratitude. Imagine a society devoid of benevolence and humility. Unlike what some people believe, Thanksgiving is not a binge fest. Yes, the meal is a bit much. The dinner table is usually groaning with the weight of the food. With the abundance of delicious food, it is understandable why people give their weighing scales a holiday. The underlying philosophy behind Thanksgiving celebration is to offer thanks to God. You dont realize how fortunate you are to be blessed with abundant food, and a loving family. Many people are not that lucky. Thanksgiving gives you an opportunity to express gratitude. Millions of American families will join their hands in prayer to say grace. Thanksgiving is integral to American culture. On Thanksgiving, say a prayer of thanks to the Almighty, for the bountiful gifts bestowed upon you. Many years ago, the Pilgrims of Plymouth did so. They shared their food with the natives of the land, who had helped them in times of misery. The tradition of sharing the Thanksgiving meal continues even today. In honor of that tradition, share your gifts with friends and family. Spread the message of gratitude and kindness with inspirational quotes for Thanksgiving. Your heartfelt words can inspire your loved ones to make Thanksgiving a festival of generosity and love. Change people forever with these inspiring words. Henry Ward Beecher Gratitude is the fairest blossom which springs from the soul. Henry Jacobsen Praise God even when you dont understand what He is doing. Thomas Fuller Gratitude is the least of the virtues, but ingratitude is the worst of vices. Irving Berlin Got no checkbooks, got no banks. Still Id like to express my thanks I got the sun in the morning and the moon at night. Odell Shepard For what I give, not what I take,For battle, not for victory,My prayer of thanks I make. G. A. Johnston Ross If I have enjoyed the hospitality of the Host of this universe, Who daily spreads a table in my sight, surely I cannot do less than acknowledge my dependence. Anne Frank I do not think of all the misery, but of the glory that remains. Go outside into the fields, nature and the sun, go out and seek happiness in yourself and in God. Think of the beauty that again and again discharges itself within and without you and be happy. Theodore Roosevelt Let us remember that, as much has been given us, much will be expected from us, and that true homage comes from the heart as well as from the lips, and shows itself in deeds. William Shakespeare Small cheer and great welcome makes a merry feast. Alice W. Brotherton Heap high the board with plenteous cheer and gather to the feast, And toast the sturdy Pilgrim band whose courage never ceased. H. W. Westermayer The pilgrims made seven times more graves than huts... nevertheless, set aside a day of thanksgiving. William Jennings Bryan On Thanksgiving Day we acknowledge our dependence. Hebrews 13:15 By him therefore let us offer the sacrifice of praise to God continually, that is, the fruit of our lips giving thanks to his name. Edward Sandford Martin Thanksgiving Day comes, by statute, once a year; to the honest man it comes as frequently as the heart of gratitude will allow. Ralph Waldo Emerson For each new morning with its light,For rest and shelter of the night,For health and food, for love and friends,For everything Thy goodness sends. O. Henry There is one day that is ours. There is one day when all we Americans who are not self-made go back to the old home to eat saleratus biscuits and marvel how much nearer to the porch the old pump looks than it used to. Thanksgiving Day is the one day that is purely American. Cynthia Ozick We often take for granted the very things that most deserve our gratitude. Robert Casper Lintner Thanksgiving is nothing if not a glad and reverent lifting of the heart to God in honor and praise for His goodness. George Washington It is the duty of all Nations to acknowledge the providence of Almighty God, to obey his will, to be grateful for his benefits, and humbly to implore his protection and favor. Robert Quillen If you count all your assets, you always show a profit. Cicero A thankful heart is not only the greatest virtue, but the parent of all the other virtues.

Reconstruction Term Paper

Reconstruction Term Paper Reconstruction Term Paper Reconstruction Term Paper If you have received an assignment to write a reconstruction term paper, you should start with narrowing the topic. Choose one aspect of the topic and develop it. Of course, if your term paper has to be 20 pages in length, the topic should be broad enough.Below is a short term paper sample written on the topic reconstruction. If you need more sample term papers, please check our term paper blog. If you need custom term paper writing service, try our professional help. Custom written paper is original and fully referenced. You will never find it posted in the Internet! Reconstruction Term Paper Sample Though Sumner and Stevens are often the only names heard in text-book accounts of Reconstruction they stood amid a remarkable group of self-made politicians. 1 Amongst them one of the most forceful was Senator Ben Wade, who had been born in 1800 of an old but poor family on a small Massachusetts farm and received little formal education. In 1821 Wade moved to Ohio and followed various occupations before beginning the study of law in 1825; with a rapidity which might be the envy of lawyers in more settled societies he was called to the bar in 1827 or 1828 and joined the firm of Joshua Giddings at the very fountainhead of political abolitionism. He became a State senator, then a judge, and in 1851 was sent to the United States Senate where he was soon recognized as an anti-slavery leader. During the war he was chairman of the key Committee on the Conduct of the War. Wade was vigorous, impulsive and likeable; men deprecated his rough methods of speech and distrusted his judgment but nev er questioned his sincerity and integrity. In 1864 Gideon Welles, though thinking that 'the old man was a little acrimonious towards the President', found Wade 'very pleasant and affable'. In 1868, when much water had flowed under the Reconstruction bridge Welles lamented that ' Wade has become demoralized, and is not the plain, single-minded, honest, unambitious man he was a few years since'. Senator Henry Wilson of Massachusetts had been born as Jeremiah Colbath in 1812. on a very poor New England farm. At the age of twenty he changed his name to Henry Wilson, and established himself as a shoemaker at Natick in Massachusetts; here he built up a considerable business and the 'cobbler of Natick' was actually a successful employer of some hundred men. His happy relations with his work-people foreshadowed the future career of one who was to prove himself the canniest vote-getter in all New England and to rise to the highest positions without ever losing touch with the simple voters of his State. Throughout his adolescence he had been an omnivorous reader, and in spite of his lack of education became a widely informed man. He entered State politics as a Whig Free Soiler and was for a time editor of the anti-slavery Boston Republican. For a short period, which he was always to regret, he joined the Know-Nothings but withdrew in protest against their intolerance and refusal to adopt antislavery views.

Todays selection processes are impartial, rational and effective. To Essay - 1

Todays selection processes are impartial, rational and effective. To what extent is this statement a myth - Essay Example In this paper, the focus will be on the selection processes of present times and whether or not these have turned out to be effective, rational and impartial with the passage of time. It will be taken care of by providing a balanced perspective – one that is in line with the thinking ideologies of the people who matter the most. One shall believe that selection processes of late have turned out to be a myth more than anything else. This is because they are usually filled with people who are either someone’s relatives or close friends. There seems to be little impartiality attached with the notion of selection and recruitment as should be the case in the perfect scenario. The selection processes usually require a great deal of input from the human resources management department and without its due role within the thick of things, the different processes can go haphazard. This is a reality that has dawned upon different organizations as far as their selection processes are concerned. It would be correct to state that selection processes are usually marred with issues which are unethical in nature as well (Smith & Robertson 1993). What this means is the fact that these selection regimes have been unable to understand how different nuances of hiring the right people are followed and thus made a benchmar k in their own right. There are problems which must be resolved in an amicable manner so that the newly hired employees have a better feel of how things will shape up in the times to come (Laser 1994). What is most important here is to realize that the selection processes should be fair in their existence and give each and every candidate a chance to prove his mettle. If this does not come about in a proper manner, there could be issues which could mar the very basis of the selection that is being done under the aegis of an organization. It is necessary to ascertain the exact basis of success within the selection processes because these would speak

Venezuela Essay Example | Topics and Well Written Essays - 1250 words

Venezuela - Essay Example However, talking in regards to culture of the region, it is highly relevant to mention the fact that Venezuela presents a mix of various other cultures which comprises of European, African, Caribbean, Indian as well as North American (Crooker and Gritzner 10). A majority of the masses communicate in the Spanish language. While talking on the lines of the religion of the masses, it has to be said that a large majority of the people are members of the Roman Catholic Church. The major cities of the country of Venezuela are Caracas and Maracaibo and as of the year 2002, the population count stood at over 24,000,000. It has to be said that the country’s main products of agricultural nature are highly diversified in nature and comprise of rice, corn, vegetables, coffee and even dairy and meat products. The manufacturing outputs of the country comprises of textile, food based products. It also comprises of aluminium, steel and automobiles. The currency of the region is Bolivar whose valuation with regards to the US currency stands at around .14 USD for 1 Bolivar. Analysis It has to be said that for in-depth analysis of the risk as well as business attractiveness presented by the country of Venezuela, the analysis should be done while trying to analyze the political, economic, social and technological environment of the nation. Political While analyzing the political environment of the country of Venezuela, immediate focus of any researcher often shifts to the fact that the nation is often plagued with various kinds of political unrest and disturbances for a long period of time. Since the last couple of decades, the world has witnessed a pretty nasty picture emerging from the political theatre of the region (Nichols and Morse 78-79). The political scenario turned quite hostile towards America, when the late Venezuelan president Hugo Chavez arrived in power since the year 1999. A staunch opponent of tactics and strategies implemented by the United States in regar ds to managing the South American nations, it can be said that the nation of Venezuela created a hostile environment in regards to political co operation between the two countries at the international level (US Dept. Of State, â€Å"US Relations with Venezuela†). Also while analyzing the upcoming political future for the nation, it has to be said that the passing away of the elected national president presents a high level of political instability as of the current times as well as the immediate future (Duddy, â€Å"Political Unrest in Venezuela†). Thus it can be analyzed that the scenario emerging from the political side of the country is quite vulnerable and instable in nature. Economic Venezuela is a country which is high on oil deposits. Hence, the country is dependent on its oil reserves, which contributes to 95% of the nation’s foreign exchange earnings. The GDP of the nation as of the year 2012 has been estimated at around 402.1 billion USD and is growing at the rate of 5.7%. It has to be said as a result of increase in spending by the government along with enhanced access to domestic credit, there was a tremendous rise of consumption which resulted in the arrival of high inflation level in the economy of the nation. Talking on a summary note, it has to be said that the economic environment of Venezuela is loaded with crisis arising from the arena of housing needs, food and electricity