White Noise The invasion of Consumerism in a PostM Essay Example For Students

White Noise The invasion of Consumerism in a PostM Essay odern Family The Invasion of Consumerism into the lives of a Post-Modern Family Consumerism is taking place everywhere. Whether we like it or not, it has come to invade our everyday modern lives. Steven Miles, a lecturer in sociology at the University of Plymouth says How we consume, why we consume, and the parameters laid down for us within which we consume have become increasingly significant influences on how we construct our everyday lives (1). Consumerism has even gotten to the point of affecting the way we go about living and controlling our personal and social lives (Miles 5). Wherever we go and whatever we do, consumerism is praised as the answer to all of our problems, an escape from some of the harsh realities of our lives. We will write a custom essay on White Noise The invasion of Consumerism in a PostM specifically for you for only $16.38 $13.9/page Order now Don DeLillos White Noise depicts the different aspects of consumerism and the effects it has post-modern family that it invades. That specific family is the Gladneys from Blacksmith. For the Gladney family, Jack, Babette, Heinrich, Steffie, Denise, and Wilder, consumerism is a way of life. It is something they are always taking part in, even if it is unconsciously. Consumerism is incorporated in with virtually every activity the family takes part in, whether it be eating out, spending a day together at the shopping mall, or making a quick stop at the supermarket. Jack Gladney is a patron of supermarkets and shopping malls (McInerney 36). Jack alone, but more frequently with the company of one or more family members, makes trips to the supermarket. The supermarket has come to be a major point of intersection in todays culture (Conroy 97). Among the busy and bustling crowds of people, Jack often runs into acquaintances, most commonly a colleague from The College on The Hill, Murray Jay Siskind: The two girls and Babette, Wilder and I went to the supermarket. Minutes after we entered, we ran into Murray. This was the fourth or fifth time Id seen him in the supermarket, which was roughly the number of times Id seen him on campus. (35) Even Jacks daughter, Denise, runs into a group of friends during one shopping trip. They all gather together to look at books and talk. Jack also has many significant conversations with Murray while casually strolling up and down the aisles of the supermarket. On one such occasion, Murray tells Jack how happy he is to be in Blacksmith, in the supermarket, in the rooming house, on the Hill (36). He continues to say I feel I am learning important things every day. Death, disease, afterlife, outerspace. Its all much clearer here. I can think and see (36). With Murray expressing his feelings to Jack, it is almost as if these encounters at the supermarket are replacing customary Aside from being a meeting grounds, the supermarket is filled with many consumer goods conveniently in bulk. Jack describes this in one of his many trips to the There were six kinds of apples, there were exotic melons in several pastels. Everything seemed to be in season, This kind of abundance of goods is seen in just about everywhere. Ten years ago, most supermarkets stocked about nine thousand items and now todays stores carry over 24 thousand (Wolkormir). Most of these items come from a can or box and can be cooked in the microwave or require no cooking at all. This explains why the number of hours parents spend cooking is going down at an increasingly rapid rate and why McDonalds so proudly displays outside their restaurants, Over 1 Billion Served. Fast food restaurants play a big role in todays growing consumerism. Americans enjoy more restaurant prepared food than ever before. Carrie Reynolds, a fast food restaurant consultant says, we eat out today more because it fits our high-speed, consumer-mad lifestyles(qtd. in Silver 42). Almost half of every dollar spent in 1999 was spent eating out, and that figure is expected to up 53% by 2010 (Silver 40). .ue0e82041934b2498d1d0730774fd226b , .ue0e82041934b2498d1d0730774fd226b .postImageUrl , .ue0e82041934b2498d1d0730774fd226b .centered-text-area { min-height: 80px; position: relative; } .ue0e82041934b2498d1d0730774fd226b , .ue0e82041934b2498d1d0730774fd226b:hover , .ue0e82041934b2498d1d0730774fd226b:visited , .ue0e82041934b2498d1d0730774fd226b:active { border:0!important; } .ue0e82041934b2498d1d0730774fd226b .clearfix:after { content: ""; display: table; clear: both; } .ue0e82041934b2498d1d0730774fd226b { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .ue0e82041934b2498d1d0730774fd226b:active , .ue0e82041934b2498d1d0730774fd226b:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .ue0e82041934b2498d1d0730774fd226b .centered-text-area { width: 100%; position: relative ; } .ue0e82041934b2498d1d0730774fd226b .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .ue0e82041934b2498d1d0730774fd226b .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .ue0e82041934b2498d1d0730774fd226b .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .ue0e82041934b2498d1d0730774fd226b:hover .ctaButton { background-color: #34495E!important; } .ue0e82041934b2498d1d0730774fd226b .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .ue0e82041934b2498d1d0730774fd226b .ue0e82041934b2498d1d0730774fd226b-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .ue0e82041934b2498d1d0730774fd226b:after { content: ""; display: block; clear: both; } READ: Essay on Poverty And Its Effects On America Essay The Gladneys are seen eating restaurant prepared food frequently, whether it be Chinese take-out night or dinner in a car outside of a commercial strip of fast food restaurants. This is common for families, especially because it is convenient for the parents busy schedules. Fast food may be convenient and seems great at the time, but in the long run, can eventually kill. One in five children between the ages of six and seventeen is overweight and if current trends continue, nearly half of todays .

buy custom The New Immigration Law essay

buy custom The New Immigration Law essay Immigration law is a government policy that checks the movement of people in a particular country. Immigration laws govern the legal status of foreigners in matters like citizenship. These laws vary from one country to another and are determined by the political climate of a country and its state of security. Some nations maintain strict immigration laws, which are aimed at controlling the rights of entry and internal rights; for instance, the right to contribute in the affairs of a government, as well as duration of visit. A majority of nations have laws which select a process for naturalizing immigrants (Archibold). For example, the United States permits over one million foreigners every year to become its lawful permanent residents, making it the leading nation in the world to receive such a large number of people. Illegal immigration began in the U.S. in 1920s and emerged to be a huge crisis in the 1980s. In 1875, a state law was passed that forbade the entry of prostitutes and criminals in the U.S. The law may have affected very few immigrants, but it marked the beginning of the division between legal and illegal immigrants. The largest immigration wave was witnessed between 1881 and 1920, in which 23.5 million immigrants entered the U.S. from various parts of the world (Archibold). Since then, people from all over the world have continued to travel to the U.S. to look for better opportunities in education, employment etc. However, after the 9/11 attack, immigration law in the United States became a very serious matter, and as a result, numerous immigration laws were enacted to control unlawful immigration (Archibold). This paper discusses the controversial new Arizona immigration law, the different reactions from its supporters and critics, as well as my opinion on the issue. In April 2010, the Arizona Immigration Law (Law SB1070) took effect in Arizona State in the United States. The law, which was seen as the toughest immigration law in the history of the U.S., provoked a national debate with some people strongly opposing the law, while others supporting it (Reuters). According to SB1070, it is a criminal offense to harbor illegal immigrants; it also requires immigrants to carry their documents wherever they go. The law gives police officers the power to stop and ask persons about their immigration status when there is a reasonable suspicion that a person is in the U.S. illegally, in the course of their traffic stops, or other actions aimed at enforcing the law (Archibold). The number of illegal immigrants in Arizona is estimated to be 460,000, and with the tough immigration law in place, it seems they have no choice but to return home. SB1070 is not only important because it involves the people of Arizona, but also because it affects the relationship of the U.S. with other countries, and consequently, its economy. Critics maintain that the law is discriminatory, targeting only Mexicans, and encourages racism and harassment of immigrants by the police (Archibold). Their arguments are backed by community activists who think that the new law will make documented immigrants in Arizona to dread dealing with police officers for fear of being harassed. No immigrant, whether documented or not, would want to call for police intervention, even when faced with serious security matters. There have been reports that documented immigrants are running away from Arizona because they fear undergoing racial profiling. Supporters of the new immigration law, however, are saying that it will reduce crime in Arizona and create more employment opportunities for the citizens of America (Archibold). My opinion is that the safety of Arizona people and the U.S. as a whole should be given priority, and therefore, this law is intended to enforce security and reduce crimes in Arizona. Even those Mexicans that, as critics claim, are targeted by this immigration law also need to be safe while walking on the streets of Arizona. I totally agree with the supporters of this law. As much as the law might seem harsh on illegal immigrants, the security and the needs of the Arizona people come first. Giving aliens the opportunity to work in Arizona to better their lives is a good thing, but allowing them to enter and stay in the U.S. illegally is very risky, since not all immigrants have good intentions. On the other hand, not all unlawful immigrants are bad, and therefore, they should not be blamed for the violence that is happening in Arizona (Beard). But the fact still remains that the U.S. is among the most powerful nations in the world, and it cannot take for granted its national security, especially after the 9/11 attack, and that is why Arizona State is not taking chances with the security of its people. Seemingly, the Obama administration is more concerned with revival of the U.S. economy and does not give more priority to immigration laws; therefore the Arizona legislature was right in passing the law to protect the Arizona state from its high crime rate. The new Arizona Immigration Law is a controversial topic that has divided people in the U.S. into two distinct groups: with one group supporting the law, while the other opposing it. Supporters argue that there has been increased violence in the border regions of Arizona, as evident by the killing of Robert Krentz, a Cochise County rancher, close to a Mexican border by a drug smuggler (Wagner). In addition, two police officers based in Phoenix were murdered by illegal immigrants in 2007, and in 2010, a deputy sheriff was injured in a gun battle by males that were alleged to be drug smugglers from Mexico City. These incidents increased a negative public perception of Arizona, with the national media depicting the region as a border for bloodshed (Wagner). The proponents of SB 1070 have cited rates of incarceration, as an indication that undocumented immigrants are contributing to the high crime rate in Arizona. Varying statistics have been reported on the number of imprisoned illegal immigrants. For instance, Jack Harris, the Phoenix Police Chief, stated that illegal immigrants constitute 10% of the arrests in his department; a number that is near to the percentage of unlawful immigrants in the U.S. Statistics from Maricopa County sheriff's office (it runs prison for Phoenix and neighboring cities), however, reported that undocumented immigrants constitute 20% of its inmates (Wagner). Proponents of the law are strongly convinced that criminals from Mexico are increasingly entering the U.S. via Arizona, thus increasing insecurity in the country. However, according to the sheriff of Pima County, Dupnik, the insecurity issue at the Arizona border was a media creation. In fact, he said that the border is more secure now than before (Wagner). Dupniks opinion was confirmed by the recent study, which found out that the numbers of immigrants who engage in crime in Arizona are fewer compared to nationals of the state. Since the 1990s when illegal immigrants began pouring in Arizona, there has been a general decrease in crime in the state; for instance, in 1995, the rate of property crimes reduced to 43%. Some critics of the Arizona immigration law are in agreement with their counterparts who support the law with regards to illegal immigrants committing fewer crimes. Nonetheless, they maintain that public safety is their main drive for supporting the law. The executive director of the Arizona Police Assn., Mr. Brian Livingston, who was previously opposed to the law, said that he changed his mind, following complaints from a Latina that illegal immigrants engaging in criminal activities in her neighborhood were not being arrested. Though he admitted that illegal immigrants come to the U.S. for a good course (seeking better life or fleeing violence in Mexico), he was quick to point out that there are criminal elements among immigrants, and they are the main target of the new law i.e. the smugglers who prey good people from Mexico (Wagner). Currently, Phoenix has developed into a center of human trafficking, and its escalating crime rate is similar to other main cities in Mexico. Over 240 cases of kidnapping and human smuggling were reported in Phoenix in 2008 alone. This shows just how insecure the state of Arizona is, and only the enforcement of a stringent law, such as the SB1070, will help bring safety to the state, and the U.S. in general (Archibold). It has been reported that illegal immigrants in Arizona sell grenades in the black market. However, Jack Harris, the Phoenix Police Chief, disagreed with this report saying that the criminality of illegal immigrants in Arizona was being exaggerated. Harris refuted the notion that getting rid of illegal immigrants will lead to a significant reduction in crime in Arizona, dismissing the argument as a political opportunism (Archibold). Civil rights activist groups, such as the American Civil Liberties Union, termed the new Arizona immigration law unconstitutional. Other people who have joined in the protests against the new Arizona immigration laws are music celebrities such as Lady Gaga, who, while addressing a gathering at the U.S. Airways Center, said that she would join hands with others to hold a peaceful protest against the law (Sacks). Even President Obama said that the law is misguided, promising that it will be looked into by the Justice Department. He said that the fact that the law necessitates aliens to carry their documents wherever they go puts them at risk of being harassed by the police, and that is not the right approach to tackling insecurity issues in the U.S. I totally disagree with those who oppose this law, who have maintained that the law is inhuman and encourages racism. I still maintain that the law is well-intentioned and is meant to protect the Arizona people from insecurity risks. It is important to note that other nations in the world have similar documentation prerequisites as Arizona. What Arizona did was merely adding a state punishment to what is already a state crime in the U.S. It has been a crime ffor foreigners in the U.S. to fail to keep their documents with them; therefore, the Arizona immigration law is nothing new; it is just an enforcement of the existing immigration law. In addition, some people argue that the law encourages racial profiling. According to Lourdes Medrano, an opponent of the law, racial profiling is illegal not only in the U.S., but also in Arizona (Archibold). He argues that the law permits police officials to stop and ask persons about their immigration status when there is a reasonable suspicion t hat a person is in the U.S. illegally, and he wonders what criteria the police would use in their assessment to determine who is an illegal immigrant. He maintains that not every illegal immigrant in the U.S. is involved in criminal activities, and that they greatly contribute to the development of the U.S. economy, and sending them away will negatively impact on the U.S. economy. This is because the jobs the illegal immigrants do are those rejected by the American citizens, yet they are very important to the U.S. economy (Archibold). I do not agree with the argument that the law encourages racial profiling; in fact, Section 2 of the Arizona Immigration law clearly states that the police cannot exclusively consider color, race or nationality to determine the immigration status of people, or to make traffic stops. Therefore, I think that this law actually prevents racial harassment by the police, because it requires officers to get in touch with the federal government immediately when they suspect that a person is illegally in the U.S., rather than arresting them based on their own evaluation (Spakovsky). Some critics of the law argue that it is unfair for the law to demand that aliens carry their driving license wherever they go. This claim is not true; the Arizona immigration law does not require anyone to carry a drivers license, be it a U.S. national or an alien. Since, only legal residents of Arizona are given licenses, a police officer assumes that a foreigner with a driving license is legally in the U.S., and therefore, he or she is given a free pass at stop points, regardless of their immigration status (Archibold). Though critics claim that the law is unconstitutional since immigration is a responsibility of the federal government, and that Arizona State has no mandate to enforce such a law, I totally disagree. I admit that Washington DC hold the key authority when it comes to matters of immigration, but it is also important to note that since 1976, the U.S. Supreme Court has recognized that the federal law should not prevent states from ratifying laws that are aimed at discouraging unlawful immigration. As long as the U.S. Congress has not outlawed this statute, then Arizona is right to implement such a law. That is why the U.S. Court of Appeal (Ninth Circuit) sustained the Arizona law in 2007, which made it unlawful to intentionally employ unauthorized foreigners in Arizona (Archibold). Supporters of the Arizona immigration law say that the law tackles the immigration issue better when compared to the federal government. According to statistics by the U.S. Border Patrol, close to 50% of seizures of illegal immigrants take place in Arizona. President Obama said in the recent past that his government will focus on illegal immigrants engaged in criminal activities, and that it is the responsibility of the Department of Justice to handle immigration, as opposed to state governments (Markon). My question is: what if the Department of Justice is reluctant in carrying out its duty, will the individual states faced with high crime rates such as Arizona sit back and do nothing? Certainly not, that is why I support the new immigration law. Arizona State is simply taking responsibility for its peoples welfare and security. Immigration law in any country is intended to govern the migration of people. In an attempt to seek for greener pastures, foreigners go to nations deemed to have better opportunities either by legal means or illegally. Increased insecurity issues especially the 9/11 attack, led the U.S. Government to enact stringent immigration laws to check the legal status of immigrants. Arizona State, especially Phoenix, has grown to be a hub for illegal immigration, and consequently, crime rates in that city have increased tremendously (Archibold). In response to the growing insecurity and crime, the Arizona legislature enacted the Arizona immigration law, a law which provoked varied opinions from the public. While critics maintain that the law is discriminatory and encourages racism, its supporters argue that the law will ensure public safety. I absolutely support the law, because public safety should be a priority of any caring nation. But since the Obama administration is more concerned with r eviving the U.S. economy at the expense of insecurity caused by illegal immigrants, the Arizona legislature was right to enact the law to get rid of the illegal immigrants, who have been associated with the increased crime rate in that state. Buy custom The New Immigration Law essay

Respond Essay Example | Topics and Well Written Essays - 500 words

Respond - Essay Example ary audience for the presentations of Davis & Shadle are the college students and the main concern drawn is the essence of the research writing as an exposure to a broad body of knowledge and personal development that comprise of the perception view and understanding of the world and the cognitive levels. Importantly, the method of starting the students in the research journey is the exposure to the published texts that initiates the motion and rest on the zones of the subject, forms and the culture, (Davis & Shadle 55). Davis and Shadle raises the concern and the importance of the research writing in the college academic progress, the grievances are presented to the students, the extent to which the research contributes to the intellectual development of a student at the college level. The presentations of the multi-genre, the multimedia text depicts how the travelers learn through under the curiosity and friendliness, (Davis & Shadle 55-56). Davis and Shadle assess the multiple disclosures to all the subject areas of interest and subject the college students to follow to the destination. The examples depict and illustrate emphasizes the form of suggesting that the culture only makes sense in the horizon of forms, appearance, values and appearance of the real world of that surrounds the students. The inquiry are based on the appreciation of the familiar as well as the problematic daily lives that are aimed at the fulfillment of the process of transformation while the topics of the research remains to be of inquisitive critique all round, ( Davis & Shadle 58-59). They advocate that the students to carry out research on the topical issues that are prone to the criticism to which the facts are developed. Davis and Shadle argue that the primary concern and the reason for Research narrow down to the level of the knowledge acquired by the individual student in the academic progress at the college level. Further, the emphasis is given to time and history that forms the

What would you do as an educator to make spanish speakers (parents and Assignment

What would you do as an educator to make spanish speakers (parents and students) feel comfortable when they meet you in a school setting - Assignment Example onal domains that are being instilled in them and hence it would be a point of advantage to take into consideration their grey areas and highlight the shortcomings for their own betterment in the long run. I believe I would do them a great service if I look after their needs and requirements and then devise a way which could eventually take care of their learning mechanisms in the long term scheme of things (Goff 2003). This would facilitate them in their quest to achieve greater things within the fields of education and learning. I would also devise the exact ways and means through which they could be assisted in the most feasible manner as far as their learning methodologies and mechanisms are related. These elements are indeed significant as these dictate the kind of optimism that is needed on the part of an educator which I have to take care of at the end of the

The Search for Identity Essay Example | Topics and Well Written Essays - 750 words

The Search for Identity - Essay Example Hence, it must be inherent for a human to search for his or her own identity all throughout his or her existence on earth. In regard to the aforementioned facts, this paper aims to dissect and explicate the search for identity in the two novels namely "Their Eyes Were Watching God" by Zora Neale Hurston and "Run With The Horsemen" by Ferrol Sams. Moreover, quotes from the said novels shall also be cited as well as to determine how it can be a conscious and, at the same time, an unconscious process, thus exemplifying the essence of this essay. Janie Mae Crawford is the protagonist in this novel. Aside from her quest for true love and standing up for her rights, despite the hindrances caused by the seemingly double jeopardy of being a woman and a black citizen- both symbolized an undeniable societal inferiority, she also has a search to find her real identity, that is, who she really is and what she is standing for. Janie's search for her identity is but a conscious effort. She knew what she really wanted: she wanted to be free! At first, she was seemingly under the control of the values that Nanny, her grandmother, has instilled in her young mind, thereby submitting herself to marry a man whom she doesn't even love. Nevertheless, her efforts to set herself free can be seen in as early as the beginning chapters of the novel, particularly when she left Logan to go with Jody. Moreover, when her relationship with Jody was "on the rocks", she has an intense desire to be free from Jody's tyranny. Eventually, after Jody's death, she has won her price of liberty. In addition, after her third husband's (Tea Cake) death, she has definitely liberated herself from all the bondage entanglements in her life. The following quotations are the salient evidences wherein Janie consciously and successfully found her identity: 1. "Now that she is alone, she begins to examine her feelings and realizes that she hates Nanny for the values with which Nanny raised her" (ch. 9). Rationale/Analysis: She was able to identify her own values as distinct from that of her grandmother's, as a result of her experiences. 2. "She looks in a mirror and sees that she has aged but is still beautiful. She rips off her head-rag, freeing her imprisoned hair..." (ch. 8). Rationale/Analysis: Soon after Jody's death, she realized her worth and her new-found freedom through this symbolic act. 3. "[As she] trudges down the main road they envy her physical beauty, particularly her long, straight hair.... [but] she doesn't stop to talk to them" (ch. 1). Rationale/Analysis: This line from the story is actually the ending part, that is, the novel is just set to do a flashback. In this scenario, Janie was walking at the road in a carefree manner. After all that had happened, she has already found her true identity and therefore, she did not bother to care about what other people will think about her because she has now emerged as a confident and an empowered woman with a unique identity. The Search for identity as seen in "Run With The Horsemen" As Porter "Sambo" Osborne Jr., the protagonist in the story, sails his journey through adolescence, his search for identity can be regarded as a natural phenomenon. This is especially true in the developmental stage where he is into. According to Erik Erikson, a renowned developmental theorist whose works are constantly cited by

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

Seeing Through the Grey Mist of Cal Poly :: Descriptive Essays

Seeing Through the Grey Mist of Cal Poly On an early Monday morning my sleepy classmates and I met at the gate to Poly Canyon. The thick marine layer circled around our group as our professor led us into the dense grey fog. A crisp breeze stung my bare cheeks sending a chill down my body. We walked past the Cerro Vista apartments, the last buildings of Cal Poly that I would see for two hours. A feeling of excitement ran through me as we began our walk down the service road and into the canyon, a place just down the street from my dorm that I had never known existed. As we trekked deeper in to the thick mist, a hidden part of Cal Poly began to reveal itself. Walls of serpentine rock rose on either side of the road and the creek below began to fill with water. Four does and a buck looked down on us from the steep slopes above. Eucalyptus trees sent a sweet fragrance through the air, and chirping birds provided soft background music for the hike. Worries of school began to fade away. The trail got rough as we started climbing up Poly Mountain. My eyes were glued to the ground. Rocks were constantly sliding under foot waiting for an opportunity to take my feet out from under me. My breath was getting shorter and my legs began to burn from the first real exercise they had gotten since leaving home. I did not know if I was going to make it up the hill. When we finally stopped for our first break, I collapsed onto the nearest rock and took some time to observe the land around me. I realized I had not looked up once throughout the first quarter of the hike. When we sat down to write I had nothing to describe or to meditate on. The thick fog had erased the trail behind us and everything surrounding it. I was filled with regret. As we continued, I made certain to look around more often. Golden grasses, patches of yucca, grand rock formations, and a solitary tree dotted the landscape. We took our second break in a community of yucca. When I sat down, one stabbed me in my thigh. Its green leaves sat motionless as though nothing had happened.

St. Quiteria Essay

St. Quiteria John 15:13 â€Å"Greater love has no one than this, that he lay down his life for his friends. † Are you willing to lay down for your life for your brothers and sisters in Christ? St. Quiteria and her sisters were not afraid to risk their lives to free Christians and wage war to stop others from being persecuted. St. Quiteria was born in the 2nd century in the city of Minho, Portugal to a mother that had nine daughters and was discussed by this.The mother had ordered the maid to kill her children but she disobeyed and sent them to a nearby village where they grew up and became good Christians. At this time in the 2nd century many Christians were being persecuted and many killed for their religions beliefs by Roman rule. In the 2nd century Rome ruled almost all of Europe and part of the Middle East. Later in life St. Quiteria and her sisters were brought before their father, who wanted them to marry Roman officials. They refused, which enraged their father who impr isoned them in a town.The sisters eventually broke out of the tower and freed all the persecuted Christians inside. Then waged a guerilla war against the Romans. St. Quiteria and her sisters were later caught and executed. I believe we need more people like St. Quiteria still today to fight persecutions here in America and other countries. I believe people should stick up for others who are being bullied and persecuted. I believe we need to fight for what we believe in and not let others fight us and do nothing about it.

Inspirational Quotes for Thanksgiving

Inspirational Quotes for Thanksgiving Imagine a nation where people did not bother to express gratitude. Imagine a society devoid of benevolence and humility. Unlike what some people believe, Thanksgiving is not a binge fest. Yes, the meal is a bit much. The dinner table is usually groaning with the weight of the food. With the abundance of delicious food, it is understandable why people give their weighing scales a holiday. The underlying philosophy behind Thanksgiving celebration is to offer thanks to God. You dont realize how fortunate you are to be blessed with abundant food, and a loving family. Many people are not that lucky. Thanksgiving gives you an opportunity to express gratitude. Millions of American families will join their hands in prayer to say grace. Thanksgiving is integral to American culture. On Thanksgiving, say a prayer of thanks to the Almighty, for the bountiful gifts bestowed upon you. Many years ago, the Pilgrims of Plymouth did so. They shared their food with the natives of the land, who had helped them in times of misery. The tradition of sharing the Thanksgiving meal continues even today. In honor of that tradition, share your gifts with friends and family. Spread the message of gratitude and kindness with inspirational quotes for Thanksgiving. Your heartfelt words can inspire your loved ones to make Thanksgiving a festival of generosity and love. Change people forever with these inspiring words. Henry Ward Beecher Gratitude is the fairest blossom which springs from the soul. Henry Jacobsen Praise God even when you dont understand what He is doing. Thomas Fuller Gratitude is the least of the virtues, but ingratitude is the worst of vices. Irving Berlin Got no checkbooks, got no banks. Still Id like to express my thanks I got the sun in the morning and the moon at night. Odell Shepard For what I give, not what I take,For battle, not for victory,My prayer of thanks I make. G. A. Johnston Ross If I have enjoyed the hospitality of the Host of this universe, Who daily spreads a table in my sight, surely I cannot do less than acknowledge my dependence. Anne Frank I do not think of all the misery, but of the glory that remains. Go outside into the fields, nature and the sun, go out and seek happiness in yourself and in God. Think of the beauty that again and again discharges itself within and without you and be happy. Theodore Roosevelt Let us remember that, as much has been given us, much will be expected from us, and that true homage comes from the heart as well as from the lips, and shows itself in deeds. William Shakespeare Small cheer and great welcome makes a merry feast. Alice W. Brotherton Heap high the board with plenteous cheer and gather to the feast, And toast the sturdy Pilgrim band whose courage never ceased. H. W. Westermayer The pilgrims made seven times more graves than huts... nevertheless, set aside a day of thanksgiving. William Jennings Bryan On Thanksgiving Day we acknowledge our dependence. Hebrews 13:15 By him therefore let us offer the sacrifice of praise to God continually, that is, the fruit of our lips giving thanks to his name. Edward Sandford Martin Thanksgiving Day comes, by statute, once a year; to the honest man it comes as frequently as the heart of gratitude will allow. Ralph Waldo Emerson For each new morning with its light,For rest and shelter of the night,For health and food, for love and friends,For everything Thy goodness sends. O. Henry There is one day that is ours. There is one day when all we Americans who are not self-made go back to the old home to eat saleratus biscuits and marvel how much nearer to the porch the old pump looks than it used to. Thanksgiving Day is the one day that is purely American. Cynthia Ozick We often take for granted the very things that most deserve our gratitude. Robert Casper Lintner Thanksgiving is nothing if not a glad and reverent lifting of the heart to God in honor and praise for His goodness. George Washington It is the duty of all Nations to acknowledge the providence of Almighty God, to obey his will, to be grateful for his benefits, and humbly to implore his protection and favor. Robert Quillen If you count all your assets, you always show a profit. Cicero A thankful heart is not only the greatest virtue, but the parent of all the other virtues.

Reconstruction Term Paper

Reconstruction Term Paper Reconstruction Term Paper Reconstruction Term Paper If you have received an assignment to write a reconstruction term paper, you should start with narrowing the topic. Choose one aspect of the topic and develop it. Of course, if your term paper has to be 20 pages in length, the topic should be broad enough.Below is a short term paper sample written on the topic reconstruction. If you need more sample term papers, please check our term paper blog. If you need custom term paper writing service, try our professional help. Custom written paper is original and fully referenced. You will never find it posted in the Internet! Reconstruction Term Paper Sample Though Sumner and Stevens are often the only names heard in text-book accounts of Reconstruction they stood amid a remarkable group of self-made politicians. 1 Amongst them one of the most forceful was Senator Ben Wade, who had been born in 1800 of an old but poor family on a small Massachusetts farm and received little formal education. In 1821 Wade moved to Ohio and followed various occupations before beginning the study of law in 1825; with a rapidity which might be the envy of lawyers in more settled societies he was called to the bar in 1827 or 1828 and joined the firm of Joshua Giddings at the very fountainhead of political abolitionism. He became a State senator, then a judge, and in 1851 was sent to the United States Senate where he was soon recognized as an anti-slavery leader. During the war he was chairman of the key Committee on the Conduct of the War. Wade was vigorous, impulsive and likeable; men deprecated his rough methods of speech and distrusted his judgment but nev er questioned his sincerity and integrity. In 1864 Gideon Welles, though thinking that 'the old man was a little acrimonious towards the President', found Wade 'very pleasant and affable'. In 1868, when much water had flowed under the Reconstruction bridge Welles lamented that ' Wade has become demoralized, and is not the plain, single-minded, honest, unambitious man he was a few years since'. Senator Henry Wilson of Massachusetts had been born as Jeremiah Colbath in 1812. on a very poor New England farm. At the age of twenty he changed his name to Henry Wilson, and established himself as a shoemaker at Natick in Massachusetts; here he built up a considerable business and the 'cobbler of Natick' was actually a successful employer of some hundred men. His happy relations with his work-people foreshadowed the future career of one who was to prove himself the canniest vote-getter in all New England and to rise to the highest positions without ever losing touch with the simple voters of his State. Throughout his adolescence he had been an omnivorous reader, and in spite of his lack of education became a widely informed man. He entered State politics as a Whig Free Soiler and was for a time editor of the anti-slavery Boston Republican. For a short period, which he was always to regret, he joined the Know-Nothings but withdrew in protest against their intolerance and refusal to adopt antislavery views.

Todays selection processes are impartial, rational and effective. To Essay - 1

Todays selection processes are impartial, rational and effective. To what extent is this statement a myth - Essay Example In this paper, the focus will be on the selection processes of present times and whether or not these have turned out to be effective, rational and impartial with the passage of time. It will be taken care of by providing a balanced perspective – one that is in line with the thinking ideologies of the people who matter the most. One shall believe that selection processes of late have turned out to be a myth more than anything else. This is because they are usually filled with people who are either someone’s relatives or close friends. There seems to be little impartiality attached with the notion of selection and recruitment as should be the case in the perfect scenario. The selection processes usually require a great deal of input from the human resources management department and without its due role within the thick of things, the different processes can go haphazard. This is a reality that has dawned upon different organizations as far as their selection processes are concerned. It would be correct to state that selection processes are usually marred with issues which are unethical in nature as well (Smith & Robertson 1993). What this means is the fact that these selection regimes have been unable to understand how different nuances of hiring the right people are followed and thus made a benchmar k in their own right. There are problems which must be resolved in an amicable manner so that the newly hired employees have a better feel of how things will shape up in the times to come (Laser 1994). What is most important here is to realize that the selection processes should be fair in their existence and give each and every candidate a chance to prove his mettle. If this does not come about in a proper manner, there could be issues which could mar the very basis of the selection that is being done under the aegis of an organization. It is necessary to ascertain the exact basis of success within the selection processes because these would speak

Venezuela Essay Example | Topics and Well Written Essays - 1250 words

Venezuela - Essay Example However, talking in regards to culture of the region, it is highly relevant to mention the fact that Venezuela presents a mix of various other cultures which comprises of European, African, Caribbean, Indian as well as North American (Crooker and Gritzner 10). A majority of the masses communicate in the Spanish language. While talking on the lines of the religion of the masses, it has to be said that a large majority of the people are members of the Roman Catholic Church. The major cities of the country of Venezuela are Caracas and Maracaibo and as of the year 2002, the population count stood at over 24,000,000. It has to be said that the country’s main products of agricultural nature are highly diversified in nature and comprise of rice, corn, vegetables, coffee and even dairy and meat products. The manufacturing outputs of the country comprises of textile, food based products. It also comprises of aluminium, steel and automobiles. The currency of the region is Bolivar whose valuation with regards to the US currency stands at around .14 USD for 1 Bolivar. Analysis It has to be said that for in-depth analysis of the risk as well as business attractiveness presented by the country of Venezuela, the analysis should be done while trying to analyze the political, economic, social and technological environment of the nation. Political While analyzing the political environment of the country of Venezuela, immediate focus of any researcher often shifts to the fact that the nation is often plagued with various kinds of political unrest and disturbances for a long period of time. Since the last couple of decades, the world has witnessed a pretty nasty picture emerging from the political theatre of the region (Nichols and Morse 78-79). The political scenario turned quite hostile towards America, when the late Venezuelan president Hugo Chavez arrived in power since the year 1999. A staunch opponent of tactics and strategies implemented by the United States in regar ds to managing the South American nations, it can be said that the nation of Venezuela created a hostile environment in regards to political co operation between the two countries at the international level (US Dept. Of State, â€Å"US Relations with Venezuela†). Also while analyzing the upcoming political future for the nation, it has to be said that the passing away of the elected national president presents a high level of political instability as of the current times as well as the immediate future (Duddy, â€Å"Political Unrest in Venezuela†). Thus it can be analyzed that the scenario emerging from the political side of the country is quite vulnerable and instable in nature. Economic Venezuela is a country which is high on oil deposits. Hence, the country is dependent on its oil reserves, which contributes to 95% of the nation’s foreign exchange earnings. The GDP of the nation as of the year 2012 has been estimated at around 402.1 billion USD and is growing at the rate of 5.7%. It has to be said as a result of increase in spending by the government along with enhanced access to domestic credit, there was a tremendous rise of consumption which resulted in the arrival of high inflation level in the economy of the nation. Talking on a summary note, it has to be said that the economic environment of Venezuela is loaded with crisis arising from the arena of housing needs, food and electricity